Integrated DNA Technologies’ Post

Did you know that the GC content of your DNA templates plays a crucial role in the success of cloning target genes into desired backbones? 💡 Gene templates with high GC content often result in higher chances of forming self-dimers or secondary structures and require higher annealing temperatures. VectorBuilder's GC Content Calculator can help with cloning sequences ranging from simple to complex. This tool allows you to determine the GC content of entire gene sequences as well as specific regions within a gene. Try it out today: https://lnkd.in/gHPJ_SK6 🧬

New porjekt about a very short DNA sequence It represents the specific gene sequence of the beta globin gene, Each base of the sequence ATGGTGCACCTGACTCCTGAGGAGAAGTCT is represented by its corresponding geometric shape and color. The bases are placed in a spiral arrangement, starting at the top right and moving clockwise. A (Adenine): red circle T (thymine): orange square G (guanine): green triangle C (cytosine): purple ellipse

1:2:1:3:6:3 Ratio Explained Codominance is a relationship between two versions of a gene. Individuals receive one version of a gene, called an allele, from each parent. If the alleles are different, the dominant allele usually will be expressed, while the effect of the other allele, called recessive, is masked. Youtube video: https://lnkd.in/d3kirvKA #nikolaysgeneticslessons

The new year provides a fresh start to reevaluate your gene synthesis provider! ENFINIA DNA is full-length, high-complexity DNA built completely cell-free and shipped NGS-verified in 6-8 days, eliminating most cloning needs. Spend more time discovering & less time cloning: https://bit.ly/4gzTXgQ #EnfiniaDNA #cellfreecloning #genesynthesis

Codominance explained Codominance Codominance is a relationship between two versions of a gene. Individuals receive one version of a gene, called an allele, from each parent. If the alleles are different, the dominant allele usually will be expressed, while the effect of the other allele, called recessive, is masked. Youtube video: https://lnkd.in/dZJ3ds_C #nikolaysgeneticslessons

The RBCs gene is located on chromosome six (6).

9:4:3 phenotypic Ratio explained Epistasis is the phenomenon where the effect of one gene (locus) is dependent on the presence of one or more 'modifier genes', i.e. the genetic background. Originally the term meant that the phenotypic effect of one gene is masked by a different gene (locus). Youtube video: https://lnkd.in/d6qTgWju #nikolaysgeneticslessons

Genes and Alleles A gene is a portion of DNA that determines a certain trait. An allele is a specific form of a gene. Genes are responsible for the expression of traits. Alleles are responsible for the variations in which a given trait can be expressed. Youtube video: https://lnkd.in/d38F6BFq #nikolaysgeneticslessons

Have you tried the GeneArt Dashboard for designing and ordering gene synthesis❔ It's the easiest way to get the custom DNA you need as sequence-verified linear fragments or clones.🧬 And if you get stuck 🆘 there are quick tutorials < 5mins to help you along the way. Check out the GeneArt Dashboard and - hot tip 🔥 - it's where you'll find our best prices! 🛍️ - https://lnkd.in/gv_DwYa7 #GeneArt #GeneSynthesis #ilovemolbio #readyforthefuture

Have you tried the GeneArt Dashboard for designing and ordering gene synthesis❔ It's the easiest way to get the custom DNA you need as sequence-verified linear fragments or clones.🧬 And if you get stuck 🆘 there are quick tutorials < 5mins to help you along the way. Check out the GeneArt Dashboard and - hot tip 🔥 - it's where you'll find our best prices! 🛍️ - https://lnkd.in/gv_DwYa7 #GeneArt #GeneSynthesis #ilovemolbio #readyforthefuture